Bacteria Collection: Staphylococcus aureus

NCTC Number:	NCTC 12981
Current Name:	Staphylococcus aureus
Other Collection No:	ATCC 25923; CIP 76.25; DSM 1104; JCM 2413; WDCM 00034
Type Strain:	No
Family:	Staphylococcaceae
Hazard Group (ACDP):	2
Release Restrictions:	Terms & Conditions of Supply of Microbial Pathogens: Safety
Conditions for growth on solid media:	Nutrient agar, 24 hours, 37°C, aerobic
Isolated From:
Whole Genome Sequence:	http://www.ebi.ac.uk/ena/data/view/ERS646605
16S rRNA Gene Sequence:	>gb|U39769|ATCC 25923|Staphylococcus aureus 16S-23S ribosomal RNA spacer region.| aaggatatattcgga... Close [x] aaggatatattcggaacatcttcttcagaagatgcggaataacgtgacatattgtattcagttttgaatgtttatttaac attcaaaaaatgggcctatagctcagctggttagagcgcacgcctgataagcgtgaggtcggtggttcgagtccacttag gcccaccattatttgtacattgaaaactagataagtaagtaaaatatagattttaccaagcaaaaccgagtgaataaaga gttttaaataagcttgaattcataagaaataatcgctagtgttcgaaagaacactcacaagattaataacgtgtttaaat ctttttataaaataaaacgtttagcagacaatgagttaaattattttaaagcagagtttacttatgtaaatgagtattta aaataatgaaaacgaagccgtatgttaacgtttgacttataaaaatggtggaaacata
23S rRNA Gene Sequence:	>gb|U39769|ATCC 25923|Staphylococcus aureus 16S-23S ribosomal RNA spacer region.| aaggatatattcgga... Close [x] aaggatatattcggaacatcttcttcagaagatgcggaataacgtgacatattgtattcagttttgaatgtttatttaac attcaaaaaatgggcctatagctcagctggttagagcgcacgcctgataagcgtgaggtcggtggttcgagtccacttag gcccaccattatttgtacattgaaaactagataagtaagtaaaatatagattttaccaagcaaaaccgagtgaataaaga gttttaaataagcttgaattcataagaaataatcgctagtgttcgaaagaacactcacaagattaataacgtgtttaaat ctttttataaaataaaacgtttagcagacaatgagttaaattattttaaagcagagtttacttatgtaaatgagtattta aaataatgaaaacgaagccgtatgttaacgtttgacttataaaaatggtggaaacata
Extended Bibliography:	Show bibliography Ref #: 81079 Author(s): Forsman,P.;Tilsala-Timisjarvi,A.;Alatossava,T. Journal: Microbiology Title: Identification of staphylococcal and streptococcal causes of bovine mastitis using 16S-23S rRNA spacer regions Volume: 143 ( Pt 11) Page(s): 3491-500 Year: 1998 Keyword(s): GENBANK/U39765 GENBANK/U39766 GENBANK/U39767 GENBANK/U39768 GENBANK/U39769 GENBANK/U39770 GENBANK/U39771 GENBANK/U39772 GENBANK/U39773 GENBANK/U39813 GENBANK/U39814 GENBANK/U90010 GENBANK/U90011 GENBANK/U90012 GENBANK/U90013 GENBANK/U90014 GENBANK/U90015 GENBANK/U90016 GENBANK/U90017 GENBANK/U90018 GENBANK/U90019 GENBANK/U90020 GENBANK/U90021 GENBANK/U90022 GENBANK/U90023 GENBANK/U90024 GENBANK/U90025 GENBANK/U90026 GENBANK/U90027 Animals Base Sequence Cattle DNA Primers DNA, Bacterial/*genetics DNA, Ribosomal/*genetics Female Mastitis, Bovine/*microbiology Milk/microbiology Molecular Sequence Data Polymerase Chain Reaction/methods RNA, Ribosomal, 16S/genetics RNA, Ribosomal, 23S/genetics Sequence Alignment Sequence Analysis, DNA Sequence Homology, Nucleic Acid Species Specificity Staphylococcus/*genetics Streptococcus/*genetics Variation (Genetics)/genetics Remarks: Bovine mastitis is caused mainly by certain Staphylococcus and Streptococcus species. The sequences of the 16S-23S rRNA spacer regions were determined for the nine species which cause mastitis: Staphylococcus aureus, Staphylococcus chromogenes, Staphylococcus epidermidis, Staphylococcus hyicus, Staphylococcus simulans, Staphylococcus xylosus, Streptococcus agalactiae, Streptococcus dysgalactiae and Streptococcus uberis. Significant variation was found between the spacer sequences of different species with the lengths of the spacers varying from 240 to 461 bp. Between genera the spacers shared only short conserved regions (8-9 bp) and within genera the sequence identities varied from 53 to 85%. This variation made it possible to construct specific primer pairs for these species and genera. The specificities of these primers were tested with 25 bacterial species and 51 isolates from cattle with clinical mastitis. The DNA-based identification of the mastitis species was mostly successful. URL: 9387227
Accession Date:	14/06/2007
Taxonomy:	TaxLink: S2775 (Staphylococcus aureus subspecies aureus rosenbach 1884) - Date of change: 16/06/2007 by NCTCUp to 16/06/2007: S4386 (Staphylococcus aureus subspecies aureus rosenbach 1884) - Date of change: 31/05/2007
Biosafety Responsibility:	It is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country

The Culture Collections hold cell cultures, bacteria, fungi and virus strains from worldwide sources. Our scientists ensure that the identification of the cultures is correct and they remain unchanged from when they are first deposited with the Collection. Nevertheless, some of the data we provide about the cultures is supplied by the person depositing the strains and, although we have multiple checking procedures in place, we cannot always verify all their data. Please note that the Culture Collections cannot be held responsible for any inaccuracies in the data provided by the depositors.

Cultures supplied by Culture Collections are to be used as controls for microbiology testing and for research purposes only. Please view the Terms & Conditions of Supply for more information.

Contact us if you want to discuss commercial use of the cultures.