Bacteria Collection: Neisseria gonorrhoeae

NCTC Number:	NCTC 8375
Current Name:	Neisseria gonorrhoeae
Original Strain Reference:	B 5025
Other Collection No:	ATCC 19424; B5025; DSM 9188
Previous Catalogue Name:	Neisseria gonorrhoeae
Type Strain:	Yes
Family:	Neisseriaceae
Hazard Group (ACDP):	2
Release Restrictions:	Terms & Conditions of Supply of Microbial Pathogens: Safety
Conditions for growth on solid media:	Chocolate blood agar, 24 hours, 37°C, requires carbon dioxide
Conditions for growth on liquid media:	nutrient broth,37, aerobic
16S rRNA Gene Sequence:	>gb|AJ247238|DSM 9188|Neisseria gonorrhoeae 16S rRNA gene, partial.| catgcaagtcggacg... Close [x] catgcaagtcggacggcagcacagggaagcttgcttctcgggtggcgagtggcgaacgggtgagtaacatatcggaacgt accgggtagcgggggataactgatcgaaagatcagctaataccgcatacgtcttgagagggaaagcaggggaccttcggg ccttgcgctatccgagcggccgatatctgattagctggttggcggggtaaaggcccaccaaggcgacgatcagtagcggg tctgagaggatgatccgccacactgggactgagacacggcccagactcctacgggaggcagcagtggggaattttggaca atgggcgcaagcctgatccagccatgccgcgtgtctgaagaaggccttcgggttgtaaaggacttttgtcagggaagaaa aggctgttgccaatatcggcggccgatgacggtacctgaagaataagcaccggctaa
23S rRNA Gene Sequence:	>gb|AJ228765|DSM 9188|Neisseria gonorrhoeae 23S rRNA gene, partial.| tgtacttgattcaaa... Close [x] tgtacttgattcaaatgcgatgtggggacggagaaggttaggttggcaagctgttggaatagcttgtttaagccggtagg tggaagacttaggcaaatccgggttttcttaacaccgagaagtgatgacgagtgtctacggacacgaagcaaccgatacc acgcttccaggaaaagccactaagcttcagtttgaatcgaaccg
Extended Bibliography:	Show bibliography Ref #: 1300 Author(s): Skerman,V.B.D.;McGowan,V.;Sneath,P.H.A.(ed) Journal: Int. J. Syst. Bacteriol. Title: Approved Lists of Bacterial Names. Volume: 30 Page(s): 225-420 Year: 1980 Ref #: 4900 Author(s): Rossau,R.;Vandenbussche,G.;Thielemans,S.;Segers,P.;Grosch,H.;Göthe,E.;Mannheim,W.;DeLey,J. Journal: Int. J. Syst. Bacteriol. Title: Ribosomal ribonucleic acid cistron similarities and deoxyribonucleic acid homologies of Neisseria, Kingella, Eikenella, Simonsiella, Alysiella, and Centers for Disease Control groups EF-4 and M-5 in the emended family Neisseriaceae. Volume: 39 Page(s): 185-198 Year: 1989 Ref #: 5166 Author(s): Reyn,A. Title: Neisseriaceae. Page(s): 429-438
Data:	(ATCC 19424) Type strain / J. F. Wilson, Sunderland in 1950
Accession Date:	01/01/1950
History:	RECEIVED FROM WILSON J F SUNDERLAND
Authority:	(Zopf 1885) Trevisan 1885
Depositor:	WILSON J F
Taxonomy:	TaxLink: S2103 (Neisseria gonorrhoeae (Zopf 1885) Trevisan 1885) - Date of change: 5/02/2003
Biosafety Responsibility:	It is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country

The Culture Collections hold cell cultures, bacteria, fungi and virus strains from worldwide sources. Our scientists ensure that the identification of the cultures is correct and they remain unchanged from when they are first deposited with the Collection. Nevertheless, some of the data we provide about the cultures is supplied by the person depositing the strains and, although we have multiple checking procedures in place, we cannot always verify all their data. Please note that the Culture Collections cannot be held responsible for any inaccuracies in the data provided by the depositors.

Cultures supplied by Culture Collections are to be used as controls for microbiology testing and for research purposes only. Please view the Terms & Conditions of Supply for more information.

Contact us if you want to discuss commercial use of the cultures.