Bacteria Collection: Bifidobacterium breve

NCTC Number:	NCTC 11815
Current Name:	Bifidobacterium breve
Original Strain Reference:	SI
Other Collection No:	ATCC 15700; DSM 20213
Previous Catalogue Name:	Bifidobacterium breve
Type Strain:	Yes
Family:	Bifidobacteriaceae
Hazard Group (ACDP):	2
Release Restrictions:	Terms & Conditions of Supply of Microbial Pathogens: Safety
Conditions for growth on solid media:	Columbia blood agar, 48 hours, 37°C, anaerobic
Isolated From:	human, intestine of infant
Whole Genome Sequence:	http://www.ebi.ac.uk/ena/data/view/ERS1247831
16S rRNA Gene Sequence:	>gb|AM411121|TYPE STRAIN:ATCC 15700|Bifidobacterium breve partial 16S rRNA gene, type strain ATCC15700T.| attaccgcggctgct... Close [x] attaccgcggctgctggcaggtagtttgccggtgcttattcgaaaggtacactcaacacaaagtgccttgctccctaaca aaagaggtttacaacccgaaggcctccatccctcacgcggcgtcgctgcatcaggcttgcgcccattgtgcaatattccc cactgctgcctcccgtagg
Bibliography:	REUTER G 1963 ZENTBL BAKT PARASIT ENKDE I ABT ORIG 191 486
Extended Bibliography:	Show bibliography Ref #: 1300 Author(s): Skerman,V.B.D.;McGowan,V.;Sneath,P.H.A.(ed) Journal: Int. J. Syst. Bacteriol. Title: Approved Lists of Bacterial Names. Volume: 30 Page(s): 225-420 Year: 1980 Ref #: 1337 Author(s): Stackebrandt,E.;Woese,C.R. Journal: Curr. Microbiol. Title: Towards a phylogeny of the actinomycetes and related organisms. Volume: 5 Page(s): 197-202 Year: 1981 Ref #: 1379 Author(s): Lauer,E.;Kandler,O. Journal: System. Appl. Microbiol. Title: DNA-DNA homology, murein types and enzyme patterns in the type strains of the genus Bifidobacterium. Volume: 4 Page(s): 42-64 Year: 1983 Ref #: 335 Author(s): Reuter,G. Journal: Zentralbl. Bakteriol. Parasitenkd. Orig. Abt. I Title: Vergleichende Untersuchungen über die Bifidus-Flora des Säuglings- und Erwachsenenstuhl. Volume: 191 Page(s): 486-507 Year: 1963 Ref #: 418 Author(s): Werner,H.;Gasser,F.;Sebald,M. Journal: Zentralbl. Bakteriol. Parasitenkd. Orig. Abt. I Title: DNS-Basenbestimmungen an 28 Bifidus-Stämmen und an Stämmen morphologisch ähnlicher Gattungen. Volume: 198 Page(s): 504-516 Year: 1965 Ref #: 429 Author(s): Kandler,O. Journal: Int. J. Syst. Bacteriol. Title: Amino acid sequence of the murein and taxonomy of the genera Lactobacillus, Bifidobacterium, Leuconostoc, and Pediococcus. Volume: 20 Page(s): 491-507 Year: 1970 Ref #: 490 Author(s): Scardovi,V.;Trovatelli,L.D.;Zani,G.;Crociani,F.;Matteuzzi,D. Journal: Int. J. Syst. Bacteriol. Title: Deoxyribonucleic acid homology relationships among species of the genus Bifidobacterium. Volume: 21 Page(s): 276-294 Year: 1971
Data:	(DSM 20213, ATCC 15700) Type strain / DSM in 1985 / G. Reuter / Intestine of infant / Reuter, G. (1963) Zentbl. Bakt. ParasitenKde. I. Abt. Orig. 191, 486
Accession Date:	01/01/1985
History:	REUTER G - DSM 1985
Authority:	Reuter 1963 (AL)
Depositor:	DSM
Taxonomy:	TaxLink: S548 (Bifidobacterium breve Reuter 1963) - Date of change: 5/02/2003
Biosafety Responsibility:	It is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country

The Culture Collections hold cell cultures, bacteria, fungi and virus strains from worldwide sources. Our scientists ensure that the identification of the cultures is correct and they remain unchanged from when they are first deposited with the Collection. Nevertheless, some of the data we provide about the cultures is supplied by the person depositing the strains and, although we have multiple checking procedures in place, we cannot always verify all their data. Please note that the Culture Collections cannot be held responsible for any inaccuracies in the data provided by the depositors.

Cultures supplied by Culture Collections are to be used as controls for microbiology testing and for research purposes only. Please view the Terms & Conditions of Supply for more information.

Contact us if you want to discuss commercial use of the cultures.