Bacteria and Mycoplasmas detail

Conditions of Supply of Microbial Pathogens: Safety

Bacteria Collection: Yersinia ruckeri

NCTC Number:	NCTC 12986
Current Name:	Yersinia ruckeri
Original Strain Reference:	CDC 2396-61
Other Collection No:	ATCC 29473; CCM 6093; CCUG 14190; CIP 82.80; DSM 18506; JCM 2429; NCIMB 2194
Other Names:	Red mouth Bacterium
Type Strain:	Yes
Family:	Enterobacteriaceae
Hazard Group (ACDP):	2
Release Restrictions:	Terms & Conditions of Supply of Microbial Pathogens: Safety
Conditions for growth on solid media:	Nutrient agar, 24-48 hours, 37°C, aerobic
Isolated From:	Rainbow Trout, Idaho, USA
Whole Genome Sequence:	http://www.ebi.ac.uk/ena/data/view/ERS670338
Annotated Genome:	ftp://ftp.sanger.ac.uk/pub/project/pathogens/NCTC3000/d...
16S rRNA Gene Sequence:	Sequence accession number: AF366385
Miscellaneous Sequence Data:	>gb\|AY370875\|ATCC 29473\|Yersinia ruckeri strain ATCC 29473 gyrase B (gyrB) gene, partialcds.\| aaagtttctggcggt... Close [x] aaagtttctggcggtttgcatggcgtgggtgtgtccgttgttaacgccctgtctgaaaaactggagttggtgattcgccg tgaaggtaaagttcacgagcagacttacaaaatgggtgtgccgcaagcaccactaaaaatggtgggtgaaaccgatcaga ccgggactacggtgcgtttctggccgagcttccagaccttcaccaataacaccgaatttcaatacgaaattctggcgaaa cgcttgcgtgagctgtcgttcctgaactccggggtttcaatcaaactgaaagacaaacgtaacgacaaagaagaccactt ccattacgaaggcggtatcaaagcgtttgttgagtatctgaacaaaaacaaaaccccgatccatccgaaagtgttctatt tctctactatgaaagat
Accession Date:	Jan 1997
Authority:	Ewing et. al. 1978 (AL)
Taxonomy:	TaxLink: S3620 (Yersinia ruckeri ewing et al. 1978) - Date of change: 31/05/2007
Biosafety Responsibility:	It is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country

Additional Information

Note: Links open in a new window

Product Documents

Note: Links open in a new window

Note:

The Culture Collections hold cell cultures, bacteria, fungi and virus strains from worldwide sources. Our scientists ensure that the identification of the cultures is correct and they remain unchanged from when they are first deposited with the Collection. Nevertheless, some of the data we provide about the cultures is supplied by the person depositing the strains and, although we have multiple checking procedures in place, we cannot always verify all their data. Please note that the Culture Collections cannot be held responsible for any inaccuracies in the data provided by the depositors.

Cultures supplied by Culture Collections are to be used as controls for microbiology testing and for research purposes only. Please view the Terms & Conditions of Supply for more information.